Subscribe to
Posts
Comments
NSLog(); Header Image

The SARS Genome

Saw an entry on Core/Dump today with the SARS genome. I copied it here, but I encourage you to click his link and pay him a visit. I'm archiving it here for my own amusement.

ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG
TAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGC
TGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTC
GTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTT
TCGTCCGTGTTGCAGTCGATCATCAGCATACCTAGGTTTCGTCCGGGTGT
GACCGAAAGGTAAGATGGAGAGCCTTGTTCTTGGTGTCAACGAGAAAACA
CACGTCCAACTCAGTTTGCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCG
TGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGAACACC
TCAAAAATGGCACTTGTGGTCTAGTAGAGCTGGAAAAAGGCGTACTGCCC
CAGCTTGAACAGCCCTATGTGTTCATTAAACGTTCTGATGCCTTAAGCAC
CAATCACGGCCACAAGGTCGTTGAGCTGGTTGCAGAAATGGACGGCATTC
AGTACGGTCGTAGCGGTATAACACTGGGAGTACTCGTGCCACATGTGGGC
GAAACCCCAATTGCATACCGCAATGTTCTTCTTCGTAAGAACGGTAATAA
GGGAGCCGGTGGTCATAGCTATGGCATCGATCTAAAGTCTTATGACTTAG
GTGACGAGCTTGGCACTGATCCCATTGAAGATTATGAACAAAACTGGAAC
ACTAAGCATGGCAGTGGTGCACTCCGTGAACTCACTCGTGAGCTCAATGG
AGGTGCAGTCACTCGCTATGTCGACAACAATTTCTGTGGCCCAGATGGGT
ACCCTCTTGATTGCATCAAAGATTTTCTCGCACGCGCGGGCAAGTCAATG
TGCACTCTTTCCGAACAACTTGATTACATCGAGTCGAAGAGAGGTGTCTA
CTGCTGCCGTGACCATGAGCATGAAATTGCCTGGTTCACTGAGCGCTCTG
ATAAGAGCTACGAGCACCAGACACCCTTCGAAATTAAGAGTGCCAAGAAA
TTTGACACTTTCAAAGGGGAATGCCCAAAGTTTGTGTTTCCTCTTAACTC
AAAAGTCAAAGTCATTCAACCACGTGTTGAAAAGAAAAAGACTGAGGGTT
TCATGGGGCGTATACGCTCTGTGTACCCTGTTGCATCTCCACAGGAGTGT
AACAATATGCACTTGTCTACCTTGATGAAATGTAATCATTGCGATGAAGT
TTCATGGCAGACGTGCGACTTTCTGAAAGCCACTTGTGAACATTGTGGCA
CTGAAAATTTAGTTATTGAAGGACCTACTACATGTGGGTACCTACCTACT
AATGCTGTAGTGAAAATGCCATGTCCTGCCTGTCAAGACCCAGAGATTGG
ACCTGAGCATAGTGTTGCAGATTATCACAACCACTCAAACATTGAAACTC
GACTCCGCAAGGGAGGTAGGACTAGATGTTTTGGAGGCTGTGTGTTTGCC
TATGTTGGCTGCTATAATAAGCGTGCCTACTGGGTTCCTCGTGCTAGTGC
TGATATTGGCTCAGGCCATACTGGCATTACTGGTGACAATGTGGAGACCT
TGAATGAGGATCTCCTTGAGATACTGAGTCGTGAACGTGTTAACATTAAC
ATTGTTGGCGATTTTCATTTGAATGAAGAGGTTGCCATCATTTTGGCATC
TTTCTCTGCTTCTACAAGTGCCTTTATTGACACTATAAAGAGTCTTGATT
ACAAGTCTTTCAAAACCATTGTTGAGTCCTGCGGTAACTATAAAGTTACC
AAGGGAAAGCCCGTAAAAGGTGCTTGGAACATTGGACAACAGAGATCAGT
TTTAACACCACTGTGTGGTTTTCCCTCACAGGCTGCTGGTGTTATCAGAT
CAATTTTTGCGCGCACACTTGATGCAGCAAACCACTCAATTCCTGATTTG
CAAAGAGCAGCTGTCACCATACTTGATGGTATTTCTGAACAGTCATTACG
TCTTGTCGACGCCATGGTTTATACTTCAGACCTGCTCACCAACAGTGTCA
TTATTATGGCATATGTAACTGGTGGTCTTGTACAACAGACTTCTCAGTGG
TTGTCTAATCTTTTGGGCACTACTGTTGAAAAACTCAGGCCTATCTTTGA
ATGGATTGAGGCGAAACTTAGTGCAGGAGTTGAATTTCTCAAGGATGCTT
GGGAGATTCTCAAATTTCTCATTACAGGTGTTTTTGACATCGTCAAGGGT
CAAATACAGGTTGCTTCAGATAACATCAAGGATTGTGTAAAATGCTTCAT
TGATGTTGTTAACAAGGCACTCGAAATGTGCATTGATCAAGTCACTATCG
CTGGCGCAAAGTTGCGATCACTCAACTTAGGTGAAGTCTTCATCGCTCAA
AGCAAGGGACTTTACCGTCAGTGTATACGTGGCAAGGAGCAGCTGCAACT
ACTCATGCCTCTTAAGGCACCAAAAGAAGTAACCTTTCTTGAAGGTGATT
CACATGACACAGTACTTACCTCTGAGGAGGTTGTTCTCAAGAACGGTGAA
CTCGAAGCACTCGAGACGCCCGTTGATAGCTTCACAAATGGAGCTATCGT
TGGCACACCAGTCTGTGTAAATGGCCTCATGCTCTTAGAGATTAAGGACA
AAGAACAATACTGCGCATTGTCTCCTGGTTTACTGGCTACAAACAATGTC
TTTCGCTTAAAAGGGGGTGCACCAATTAAAGGTGTAACCTTTGGAGAAGA
TACTGTTTGGGAAGTTCAAGGTTACAAGAATGTGAGAATCACATTTGAGC
TTGATGAACGTGTTGACAAAGTGCTTAATGAAAAGTGCTCTGTCTACACT
GTTGAATCCGGTACCGAAGTTACTGAGTTTGCATGTGTTGTAGCAGAGGC
TGTTGTGAAGACTTTACAACCAGTTTCTGATCTCCTTACCAACATGGGTA
TTGATCTTGATGAGTGGAGTGTAGCTACATTCTACTTATTTGATGATGCT
GGTGAAGAAAACTTTTCATCACGTATGTATTGTTCCTTTTACCCTCCAGA
TGAGGAAGAAGAGGACGATGCAGAGTGTGAGGAAGAAGAAATTGATGAAA
CCTGTGAACATGAGTACGGTACAGAGGATGATTATCAAGGTCTCCCTCTG
GAATTTGGTGCCTCAGCTGAAACAGTTCGAGTTGAGGAAGAAGAAGAGGA
AGACTGGCTGGATGATACTACTGAGCAATCAGAGATTGAGCCAGAACCAG
AACCTACACCTGAAGAACCAGTTAATCAGTTTACTGGTTATTTAAAACTT
ACTGACAATGTTGCCATTAAATGTGTTGACATCGTTAAGGAGGCACAAAG
TGCTAATCCTATGGTGATTGTAAATGCTGCTAACATACACCTGAAACATG
GTGGTGGTGTAGCAGGTGCACTCAACAAGGCAACCAATGGTGCCATGCAA
AAGGAGAGTGATGATTACATTAAGCTAAATGGCCCTCTTACAGTAGGAGG
GTCTTGTTTGCTTTCTGGACATAATCTTGCTAAGAAGTGTCTGCATGTTG
TTGGACCTAACCTAAATGCAGGTGAGGACATCCAGCTTCTTAAGGCAGCA
TATGAAAATTTCAATTCACAGGACATCTTACTTGCACCATTGTTGTCAGC
AGGCATATTTGGTGCTAAACCACTTCAGTCTTTACAAGTGTGCGTGCAGA
CGGTTCGTACACAGGTTTATATTGCAGTCAATGACAAAGCTCTTTATGAG
CAGGTTGTCATGGATTATCTTGATAACCTGAAGCCTAGAGTGGAAGCACC
TAAACAAGAGGAGCCACCAAACACAGAAGATTCCAAAACTGAGGAGAAAT
CTGTCGTACAGAAGCCTGTCGATGTGAAGCCAAAAATTAAGGCCTGCATT
GATGAGGTTACCACAACACTGGAAGAAACTAAGTTTCTTACCAATAAGTT
ACTCTTGTTTGCTGATATCAATGGTAAGCTTTACCATGATTCTCAGAACA
TGCTTAGAGGTGAAGATATGTCTTTCCTTGAGAAGGATGCACCTTACATG
GTAGGTGATGTTATCACTAGTGGTGATATCACTTGTGTTGTAATACCCTC
CAAAAAGGCTGGTGGCACTACTGAGATGCTCTCAAGAGCTTTGAAGAAAG
TGCCAGTTGATGAGTATATAACCACGTACCCTGGACAAGGATGTGCTGGT
TATACACTTGAGGAAGCTAAGACTGCTCTTAAGAAATGCAAATCTGCATT
TTATGTACTACCTTCAGAAGCACCTAATGCTAAGGAAGAGATTCTAGGAA
CTGTATCCTGGAATTTGAGAGAAATGCTTGCTCATGCTGAAGAGACAAGA
AAATTAATGCCTATATGCATGGATGTTAGAGCCATAATGGCAACCATCCA
ACGTAAGTATAAAGGAATTAAAATTCAAGAGGGCATCGTTGACTATGGTG
TCCGATTCTTCTTTTATACTAGTAAAGAGCCTGTAGCTTCTATTATTACG
AAGCTGAACTCTCTAAATGAGCCGCTTGTCACAATGCCAATTGGTTATGT
GACACATGGTTTTAATCTTGAAGAGGCTGCGCGCTGTATGCGTTCTCTTA
AAGCTCCTGCCGTAGTGTCAGTATCATCACCAGATGCTGTTACTACATAT
AATGGATACCTCACTTCGTCATCAAAGACATCTGAGGAGCACTTTGTAGA
AACAGTTTCTTTGGCTGGCTCTTACAGAGATTGGTCCTATTCAGGACAGC
GTACAGAGTTAGGTGTTGAATTTCTTAAGCGTGGTGACAAAATTGTGTAC
CACACTCTGGAGAGCCCCGTCGAGTTTCATCTTGACGGTGAGGTTCTTTC
ACTTGACAAACTAAAGAGTCTCTTATCCCTGCGGGAGGTTAAGACTATAA
AAGTGTTCACAACTGTGGACAACACTAATCTCCACACACAGCTTGTGGAT
ATGTCTATGACATATGGACAGCAGTTTGGTCCAACATACTTGGATGGTGC
TGATGTTACAAAAATTAAACCTCATGTAAATCATGAGGGTAAGACTTTCT
TTGTACTACCTAGTGATGACACACTACGTAGTGAAGCTTTCGAGTACTAC
CATACTCTTGATGAGAGTTTTCTTGGTAGGTACATGTCTGCTTTAAACCA
CACAAAGAAATGGAAATTTCCTCAAGTTGGTGGTTTAACTTCAATTAAAT
GGGCTGATAACAATTGTTATTTGTCTAGTGTTTTATTAGCACTTCAACAG
CTTGAAGTCAAATTCAATGCACCAGCACTTCAAGAGGCTTATTATAGAGC
CCGTGCTGGTGATGCTGCTAACTTTTGTGCACTCATACTCGCTTACAGTA
ATAAAACTGTTGGCGAGCTTGGTGATGTCAGAGAAACTATGACCCATCTT
CTACAGCATGCTAATTTGGAATCTGCAAAGCGAGTTCTTAATGTGGTGTG
TAAACATTGTGGTCAGAAAACTACTACCTTAACGGGTGTAGAAGCTGTGA
TGTATATGGGTACTCTATCTTATGATAATCTTAAGACAGGTGTTTCCATT
CCATGTGTGTGTGGTCGTGATGCTACACAATATCTAGTACAACAAGAGTC
TTCTTTTGTTATGATGTCTGCACCACCTGCTGAGTATAAATTACAGCAAG
GTACATTCTTATGTGCGAATGAGTACACTGGTAACTATCAGTGTGGTCAT
TACACTCATATAACTGCTAAGGAGACCCTCTATCGTATTGACGGAGCTCA
CCTTACAAAGATGTCAGAGTACAAAGGACCAGTGACTGATGTTTTCTACA
AGGAAACATCTTACACTACAACCATCAAGCCTGTGTCGTATAAACTCGAT
GGAGTTACTTACACAGAGATTGAACCAAAATTGGATGGGTATTATAAAAA
GGATAATGCTTACTATACAGAGCAGCCTATAGACCTTGTACCAACTCAAC
CATTACCAAATGCGAGTTTTGATAATTTCAAACTCACATGTTCTAACACA
AAATTTGCTGATGATTTAAATCAAATGACAGGCTTCACAAAGCCAGCTTC
ACGAGAGCTATCTGTCACATTCTTCCCAGACTTGAATGGCGATGTAGTGG
CTATTGACTATAGACACTATTCAGCGAGTTTCAAGAAAGGTGCTAAATTA
CTGCATAAGCCAATTGTTTGGCACATTAACCAGGCTACAACCAAGACAAC
GTTCAAACCAAACACTTGGTGTTTACGTTGTCTTTGGAGTACAAAGCCAG
TAGATACTTCAAATTCATTTGAAGTTCTGGCAGTAGAAGACACACAAGGA
ATGGACAATCTTGCTTGTGAAAGTCAACAACCCACCTCTGAAGAAGTAGT
GGAAAATCCTACCATACAGAAGGAAGTCATAGAGTGTGACGTGAAAACTA
CCGAAGTTGTAGGCAATGTCATACTTAAACCATCAGATGAAGGTGTTAAA
GTAACACAAGAGTTAGGTCATGAGGATCTTATGGCTGCTTATGTGGAAAA
CACAAGCATTACCATTAAGAAACCTAATGAGCTTTCACTAGCCTTAGGTT
TAAAAACAATTGCCACTCATGGTATTGCTGCAATTAATAGTGTTCCTTGG
AGTAAAATTTTGGCTTATGTCAAACCATTCTTAGGACAAGCAGCAATTAC
AACATCAAATTGCGCTAAGAGATTAGCACAACGTGTGTTTAACAATTATA
TGCCTTATGTGTTTACATTATTGTTCCAATTGTGTACTTTTACTAAAAGT
ACCAATTCTAGAATTAGAGCTTCACTACCTACAACTATTGCTAAAAATAG
TGTTAAGAGTGTTGCTAAATTATGTTTGGATGCCGGCATTAATTATGTGA
AGTCACCCAAATTTTCTAAATTGTTCACAATCGCTATGTGGCTATTGTTG
TTAAGTATTTGCTTAGGTTCTCTAATCTGTGTAACTGCTGCTTTTGGTGT
ACTCTTATCTAATTTTGGTGCTCCTTCTTATTGTAATGGCGTTAGAGAAT
TGTATCTTAATTCGTCTAACGTTACTACTATGGATTTCTGTGAAGGTTCT
TTTCCTTGCAGCATTTGTTTAAGTGGATTAGACTCCCTTGATTCTTATCC
AGCTCTTGAAACCATTCAGGTGACGATTTCATCGTACAAGCTAGACTTGA
CAATTTTAGGTCTGGCCGCTGAGTGGGTTTTGGCATATATGTTGTTCACA
AAATTCTTTTATTTATTAGGTCTTTCAGCTATAATGCAGGTGTTCTTTGG
CTATTTTGCTAGTCATTTCATCAGCAATTCTTGGCTCATGTGGTTTATCA
TTAGTATTGTACAAATGGCACCCGTTTCTGCAATGGTTAGGATGTACATC
TTCTTTGCTTCTTTCTACTACATATGGAAGAGCTATGTTCATATCATGGA
TGGTTGCACCTCTTCGACTTGCATGATGTGCTATAAGCGCAATCGTGCCA
CACGCGTTGAGTGTACAACTATTGTTAATGGCATGAAGAGATCTTTCTAT
GTCTATGCAAATGGAGGCCGTGGCTTCTGCAAGACTCACAATTGGAATTG
TCTCAATTGTGACACATTTTGCACTGGTAGTACATTCATTAGTGATGAAG
TTGCTCGTGATTTGTCACTCCAGTTTAAAAGACCAATCAACCCTACTGAC
CAGTCATCGTATATTGTTGATAGTGTTGCTGTGAAAAATGGCGCGCTTCA
CCTCTACTTTGACAAGGCTGGTCAAAAGACCTATGAGAGACATCCGCTCT
CCCATTTTGTCAATTTAGACAATTTGAGAGCTAACAACACTAAAGGTTCA
CTGCCTATTAATGTCATAGTTTTTGATGGCAAGTCCAAATGCGACGAGTC
TGCTTCTAAGTCTGCTTCTGTGTACTACAGTCAGCTGATGTGCCAACCTA
TTCTGTTGCTTGACCAAGCTCTTGTATCAGACGTTGGAGATAGTACTGAA
GTTTCCGTTAAGATGTTTGATGCTTATGTCGACACCTTTTCAGCAACTTT
TAGTGTTCCTATGGAAAAACTTAAGGCACTTGTTGCTACAGCTCACAGCG
AGTTAGCAAAGGGTGTAGCTTTAGATGGTGTCCTTTCTACATTCGTGTCA
GCTGCCCGACAAGGTGTTGTTGATACCGATGTTGACACAAAGGATGTTAT
TGAATGTCTCAAACTTTCACATCACTCTGACTTAGAAGTGACAGGTGACA
GTTGTAACAATTTCATGCTCACCTATAATAAGGTTGAAAACATGACGCCC
AGAGATCTTGGCGCATGTATTGACTGTAATGCAAGGCATATCAATGCCCA
AGTAGCAAAAAGTCACAATGTTTCACTCATCTGGAATGTAAAAGACTACA
TGTCTTTATCTGAACAGCTGCGTAAACAAATTCGTAGTGCTGCCAAGAAG
AACAACATACCTTTTAGACTAACTTGTGCTACAACTAGACAGGTTGTCAA
TGTCATAACTACTAAAATCTCACTCAAGGGTGGTAAGATTGTTAGTACTT
GTTTTAAACTTATGCTTAAGGCCACATTATTGTGCGTTCTTGCTGCATTG
GTTTGTTATATCGTTATGCCAGTACATACATTGTCAATCCATGATGGTTA
CACAAATGAAATCATTGGTTACAAAGCCATTCAGGATGGTGTCACTCGTG
ACATCATTTCTACTGATGATTGTTTTGCAAATAAACATGCTGGTTTTGAC
GCATGGTTTAGCCAGCGTGGTGGTTCATACAAAAATGACAAAAGCTGCCC
TGTAGTAGCTGCTATCATTACAAGAGAGATTGGTTTCATAGTGCCTGGCT
TACCGGGTACTGTGCTGAGAGCAATCAATGGTGACTTCTTGCATTTTCTA
CCTCGTGTTTTTAGTGCTGTTGGCAACATTTGCTACACACCTTCCAAACT
CATTGAGTATAGTGATTTTGCTACCTCTGCTTGCGTTCTTGCTGCTGAGT
GTACAATTTTTAAGGATGCTATGGGCAAACCTGTGCCATATTGTTATGAC
ACTAATTTGCTAGAGGGTTCTATTTCTTATAGTGAGCTTCGTCCAGACAC
TCGTTATGTGCTTATGGATGGTTCCATCATACAGTTTCCTAACACTTACC
TGGAGGGTTCTGTTAGAGTAGTAACAACTTTTGATGCTGAGTACTGTAGA
CATGGTACATGCGAAAGGTCAGAAGTAGGTATTTGCCTATCTACCAGTGG
TAGATGGGTTCTTAATAATGAGCATTACAGAGCTCTATCAGGAGTTTTCT
GTGGTGTTGATGCGATGAATCTCATAGCTAACATCTTTACTCCTCTTGTG
CAACCTGTGGGTGCTTTAGATGTGTCTGCTTCAGTAGTGGCTGGTGGTAT
TATTGCCATATTGGTGACTTGTGCTGCCTACTACTTTATGAAATTCAGAC
GTGTTTTTGGTGAGTACAACCATGTTGTTGCTGCTAATGCACTTTTGTTT
TTGATGTCTTTCACTATACTCTGTCTGGTACCAGCTTACAGCTTTCTGCC
GGGAGTCTACTCAGTCTTTTACTTGTACTTGACATTCTATTTCACCAATG
ATGTTTCATTCTTGGCTCACCTTCAATGGTTTGCCATGTTTTCTCCTATT
GTGCCTTTTTGGATAACAGCAATCTATGTATTCTGTATTTCTCTGAAGCA
CTGCCATTGGTTCTTTAACAACTATCTTAGGAAAAGAGTCATGTTTAATG
GAGTTACATTTAGTACCTTCGAGGAGGCTGCTTTGTGTACCTTTTTGCTC
AACAAGGAAATGTACCTAAAATTGCGTAGCGAGACACTGTTGCCACTTAC
ACAGTATAACAGGTATCTTGCTCTATATAACAAGTACAAGTATTTCAGTG
GAGCCTTAGATACTACCAGCTATCGTGAAGCAGCTTGCTGCCACTTAGCA
AAGGCTCTAAATGACTTTAGCAACTCAGGTGCTGATGTTCTCTACCAACC
ACCACAGACATCAATCACTTCTGCTGTTCTGCAGAGTGGTTTTAGGAAAA
TGGCATTCCCGTCAGGCAAAGTTGAAGGGTGCATGGTACAAGTAACCTGT
GGAACTACAACTCTTAATGGATTGTGGTTGGATGACACAGTATACTGTCC
AAGACATGTCATTTGCACAGCAGAAGACATGCTTAATCCTAACTATGAAG
ATCTGCTCATTCGCAAATCCAACCATAGCTTTCTTGTTCAGGCTGGCAAT
GTTCAACTTCGTGTTATTGGCCATTCTATGCAAAATTGTCTGCTTAGGCT
TAAAGTTGATACTTCTAACCCTAAGACACCCAAGTATAAATTTGTCCGTA
TCCAACCTGGTCAAACATTTTCAGTTCTAGCATGCTACAATGGTTCACCA
TCTGGTGTTTATCAGTGTGCCATGAGACCTAATCATACCATTAAAGGTTC
TTTCCTTAATGGATCATGTGGTAGTGTTGGTTTTAACATTGATTATGATT
GCGTGTCTTTCTGCTATATGCATCATATGGAGCTTCCAACAGGAGTACAC
GCTGGTACTGACTTAGAAGGTAAATTCTATGGTCCATTTGTTGACAGACA
AACTGCACAGGCTGCAGGTACAGACACAACCATAACATTAAATGTTTTGG
CATGGCTGTATGCTGCTGTTATCAATGGTGATAGGTGGTTTCTTAATAGA
TTCACCACTACTTTGAATGACTTTAACCTTGTGGCAATGAAGTACAACTA
TGAACCTTTGACACAAGATCATGTTGACATATTGGGACCTCTTTCTGCTC
AAACAGGAATTGCCGTCTTAGATATGTGTGCTGCTTTGAAAGAGCTGCTG
CAGAATGGTATGAATGGTCGTACTATCCTTGGTAGCACTATTTTAGAAGA
TGAGTTTACACCATTTGATGTTGTTAGACAATGCTCTGGTGTTACCTTCC
AAGGTAAGTTCAAGAAAATTGTTAAGGGCACTCATCATTGGATGCTTTTA
ACTTTCTTGACATCACTATTGATTCTTGTTCAAAGTACACAGTGGTCACT
GTTTTTCTTTGTTTACGAGAATGCTTTCTTGCCATTTACTCTTGGTATTA
TGGCAATTGCTGCATGTGCTATGCTGCTTGTTAAGCATAAGCACGCATTC
TTGTGCTTGTTTCTGTTACCTTCTCTTGCAACAGTTGCTTACTTTAATAT
GGTCTACATGCCTGCTAGCTGGGTGATGCGTATCATGACATGGCTTGAAT
TGGCTGACACTAGCTTGTCTGGTTATAGGCTTAAGGATTGTGTTATGTAT
GCTTCAGCTTTAGTTTTGCTTATTCTCATGACAGCTCGCACTGTTTATGA
TGATGCTGCTAGACGTGTTTGGACACTGATGAATGTCATTACACTTGTTT
ACAAAGTCTACTATGGTAATGCTTTAGATCAAGCTATTTCCATGTGGGCC
TTAGTTATTTCTGTAACCTCTAACTATTCTGGTGTCGTTACGACTATCAT
GTTTTTAGCTAGAGCTATAGTGTTTGTGTGTGTTGAGTATTACCCATTGT
TATTTATTACTGGCAACACCTTACAGTGTATCATGCTTGTTTATTGTTTC
TTAGGCTATTGTTGCTGCTGCTACTTTGGCCTTTTCTGTTTACTCAACCG
TTACTTCAGGCTTACTCTTGGTGTTTATGACTACTTGGTCTCTACACAAG
AATTTAGGTATATGAACTCCCAGGGGCTTTTGCCTCCTAAGAGTAGTATT
GATGCTTTCAAGCTTAACATTAAGTTGTTGGGTATTGGAGGTAAACCATG
TATCAAGGTTGCTACTGTACAGTCTAAAATGTCTGACGTAAAGTGCACAT
CTGTGGTACTGCTCTCGGTTCTTCAACAACTTAGAGTAGAGTCATCTTCT
AAATTGTGGGCACAATGTGTACAACTCCACAATGATATTCTTCTTGCAAA
AGACACAACTGAAGCTTTCGAGAAGATGGTTTCTCTTTTGTCTGTTTTGC
TATCCATGCAGGGTGCTGTAGACATTAATAGGTTGTGCGAGGAAATGCTC
GATAACCGTGCTACTCTTCAGGCTATTGCTTCAGAATTTAGTTCTTTACC
ATCATATGCCGCTTATGCCACTGCCCAGGAGGCCTATGAGCAGGCTGTAG
CTAATGGTGATTCTGAAGTCGTTCTCAAAAAGTTAAAGAAATCTTTGAAT
GTGGCTAAATCTGAGTTTGACCGTGATGCTGCCATGCAACGCAAGTTGGA
AAAGATGGCAGATCAGGCTATGACCCAAATGTACAAACAGGCAAGATCTG
AGGACAAGAGGGCAAAAGTAACTAGTGCTATGCAAACAATGCTCTTCACT
ATGCTTAGGAAGCTTGATAATGATGCACTTAACAACATTATCAACAATGC
GCGTGATGGTTGTGTTCCACTCAACATCATACCATTGACTACAGCAGCCA
AACTCATGGTTGTTGTCCCTGATTATGGTACCTACAAGAACACTTGTGAT
GGTAACACCTTTACATATGCATCTGCACTCTGGGAAATCCAGCAAGTTGT
TGATGCGGATAGCAAGATTGTTCAACTTAGTGAAATTAACATGGACAATT
CACCAAATTTGGCTTGGCCTCTTATTGTTACAGCTCTAAGAGCCAACTCA
GCTGTTAAACTACAGAATAATGAACTGAGTCCAGTAGCACTACGACAGAT
GTCCTGTGCGGCTGGTACCACACAAACAGCTTGTACTGATGACAATGCAC
TTGCCTACTATAACAATTCGAAGGGAGGTAGGTTTGTGCTGGCATTACTA
TCAGACCACCAAGATCTCAAATGGGCTAGATTCCCTAAGAGTGATGGTAC
AGGTACAATTTACACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACA
CACCAAAAGGGCCTAAAGTGAAATACTTGTACTTCATCAAAGGCTTAAAC
AACCTAAATAGAGGTATGGTGCTGGGCAGTTTAGCTGCTACAGTACGTCT
TCAGGCTGGAAATGCTACAGAAGTACCTGCCAATTCAACTGTGCTTTCCT
TCTGTGCTTTTGCAGTAGACCCTGCTAAAGCATATAAGGATTACCTAGCA
AGTGGAGGACAACCAATCACCAACTGTGTGAAGATGTTGTGTACACACAC
TGGTACAGGACAGGCAATTACTGTAACACCAGAAGCTAACATGGACCAAG
AGTCCTTTGGTGGTGCTTCATGTTGTCTGTATTGTAGATGCCACATTGAC
CATCCAAATCCTAAAGGATTCTGTGACTTGAAAGGTAAGTACGTCCAAAT
ACCTACCACTTGTGCTAATGACCCAGTGGGTTTTACACTTAGAAACACAG
TCTGTACCGTCTGCGGAATGTGGAAAGGTTATGGCTGTAGTTGTGACCAA
CTCCGCGAACCCTTGATGCAGTCTGCGGATGCATCAACGTTTTTAAACGG
GTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAG
TACTGATGTCGTCTACAGGGCTTTTGATATTTACAACGAAAAAGTTGCTG
GTTTTGCAAAGTTCCTAAAAACTAATTGCTGTCGCTTCCAGGAGAAGGAT
GAGGAAGGCAATTTATTAGACTCTTACTTTGTAGTTAAGAGGCATACTAT
GTCTAACTACCAACATGAAGAGACTATTTATAACTTGGTTAAAGATTGTC
CAGCGGTTGCTGTCCATGACTTTTTCAAGTTTAGAGTAGATGGTGACATG
GTACCACATATATCACGTCAGCGTCTAACTAAATACACAATGGCTGATTT
AGTCTATGCTCTACGTCATTTTGATGAGGGTAATTGTGATACATTAAAAG
AAATACTCGTCACATACAATTGCTGTGATGATGATTATTTCAATAAGAAG
GATTGGTATGACTTCGTAGAGAATCCTGACATCTTACGCGTATATGCTAA
CTTAGGTGAGCGTGTACGCCAATCATTATTAAAGACTGTACAATTCTGCG
ATGCTATGCGTGATGCAGGCATTGTAGGCGTACTGACATTAGATAATCAG
GATCTTAATGGGAACTGGTACGATTTCGGTGATTTCGTACAAGTAGCACC
AGGCTGCGGAGTTCCTATTGTGGATTCATATTACTCATTGCTGATGCCCA
TCCTCACTTTGACTAGGGCATTGGCTGCTGAGTCCCATATGGATGCTGAT
CTCGCAAAACCACTTATTAAGTGGGATTTGCTGAAATATGATTTTACGGA
AGAGAGACTTTGTCTCTTCGACCGTTATTTTAAATATTGGGACCAGACAT
ACCATCCCAATTGTATTAACTGTTTGGATGATAGGTGTATCCTTCATTGT
GCAAACTTTAATGTGTTATTTTCTACTGTGTTTCCACCTACAAGTTTTGG
ACCACTAGTAAGAAAAATATTTGTAGATGGTGTTCCTTTTGTTGTTTCAA
CTGGATACCATTTTCGTGAGTTAGGAGTCGTACATAATCAGGATGTAAAC
TTACATAGCTCGCGTCTCAGTTTCAAGGAACTTTTAGTGTATGCTGCTGA
TCCAGCTATGCATGCAGCTTCTGGCAATTTATTGCTAGATAAACGCACTA
CATGCTTTTCAGTAGCTGCACTAACAAACAATGTTGCTTTTCAAACTGTC
AAACCCGGTAATTTTAATAAAGACTTTTATGACTTTGCTGTGTCTAAAGG
TTTCTTTAAGGAAGGAAGTTCTGTTGAACTAAAACACTTCTTCTTTGCTC
AGGATGGCAACGCTGCTATCAGTGATTATGACTATTATCGTTATAATCTG
CCAACAATGTGTGATATCAGACAACTCCTATTCGTAGTTGAAGTTGTTGA
TAAATACTTTGATTGTTACGATGGTGGCTGTATTAATGCCAACCAAGTAA
TCGTTAACAATCTGGATAAATCAGCTGGTTTCCCATTTAATAAATGGGGT
AAGGCTAGACTTTATTATGACTCAATGAGTTATGAGGATCAAGATGCACT
TTTCGCGTATACTAAGCGTAATGTCATCCCTACTATAACTCAAATGAATC
TTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC
TCTATCTGTAGTACTATGACAAATAGACAGTTTCATCAGAAATTATTGAA
GTCAATAGCCGCCACTAGAGGAGCTACTGTGGTAATTGGAACAAGCAAGT
TTTACGGTGGCTGGCATAATATGTTAAAAACTGTTTACAGTGATGTAGAA
ACTCCACACCTTATGGGTTGGGATTATCCAAAATGTGACAGAGCCATGCC
TAACATGCTTAGGATAATGGCCTCTCTTGTTCTTGCTCGCAAACATAACA
CTTGCTGTAACTTATCACACCGTTTCTACAGGTTAGCTAACGAGTGTGCG
CAAGTATTAAGTGAGATGGTCATGTGTGGCGGCTCACTATATGTTAAACC
AGGTGGAACATCATCCGGTGATGCTACAACTGCTTATGCTAATAGTGTCT
TTAACATTTGTCAAGCTGTTACAGCCAATGTAAATGCACTTCTTTCAACT
GATGGTAATAAGATAGCTGACAAGTATGTCCGCAATCTACAACACAGGCT
CTATGAGTGTCTCTATAGAAATAGGGATGTTGATCATGAATTCGTGGATG
AGTTTTACGCTTACCTGCGTAAACATTTCTCCATGATGATTCTTTCTGAT
GATGCCGTTGTGTGCTATAACAGTAACTATGCGGCTCAAGGTTTAGTAGC
TAGCATTAAGAACTTTAAGGCAGTTCTTTATTATCAAAATAATGTGTTCA
TGTCTGAGGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCAC
GAATTTTGCTCACAGCATACAATGCTAGTTAAACAAGGAGATGATTACGT
GTACCTGCCTTACCCAGATCCATCAAGAATATTAGGCGCAGGCTGTTTTG
TCGATGATATTGTCAAAACAGATGGTACACTTATGATTGAAAGGTTCGTG
TCACTGGCTATTGATGCTTACCCACTTACAAAACATCCTAATCAGGAGTA
TGCTGATGTCTTTCACTTGTATTTACAATACATTAGAAAGTTACATGATG
AGCTTACTGGCCACATGTTGGACATGTATTCCGTAATGCTAACTAATGAT
AACACCTCACGGTACTGGGAACCTGAGTTTTATGAGGCTATGTACACACC
ACATACAGTCTTGCAGGCTGTAGGTGCTTGTGTATTGTGCAATTCACAGA
CTTCACTTCGTTGCGGTGCCTGTATTAGGAGACCATTCCTATGTTGCAAG
TGCTGCTATGACCATGTCATTTCAACATCACACAAATTAGTGTTGTCTGT
TAATCCCTATGTTTGCAATGCCCCAGGTTGTGATGTCACTGATGTGACAC
AACTGTATCTAGGAGGTATGAGCTATTATTGCAAGTCACATAAGCCTCCC
ATTAGTTTTCCATTATGTGCTAATGGTCAGGTTTTTGGTTTATACAAAAA
CACATGTGTAGGCAGTGACAATGTCACTGACTTCAATGCGATAGCAACAT
GTGATTGGACTAATGCTGGCGATTACATACTTGCCAACACTTGTACTGAG
AGACTCAAGCTTTTCGCAGCAGAAACGCTCAAAGCCACTGAGGAAACATT
TAAGCTGTCATATGGTATTGCCACTGTACGCGAAGTACTCTCTGACAGAG
AATTGCATCTTTCATGGGAGGTTGGAAAACCTAGACCACCATTGAACAGA
AACTATGTCTTTACTGGTTACCGTGTAACTAAAAATAGTAAAGTACAGAT
TGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTGTACA
GAGGTACTACGACATACAAGTTGAATGTTGGTGATTACTTTGTGTTGACA
TCTCACACTGTAATGCCACTTAGTGCACCTACTCTAGTGCCACAAGAGCA
CTATGTGAGAATTACTGGCTTGTACCCAACACTCAACATCTCAGATGAGT
TTTCTAGCAATGTTGCAAATTATCAAAAGGTCGGCATGCAAAAGTACTCT
ACACTCCAAGGACCACCTGGTACTGGTAAGAGTCATTTTGCCATCGGACT
TGCTCTCTATTACCCATCTGCTCGCATAGTGTATACGGCATGCTCTCATG
CAGCTGTTGATGCCCTATGTGAAAAGGCATTAAAATATTTGCCCATAGAT
AAATGTAGTAGAATCATACCTGCGCGTGCGCGCGTAGAGTGTTTTGATAA
ATTCAAAGTGAATTCAACACTAGAACAGTATGTTTTCTGCACTGTAAATG
CATTGCCAGAAACAACTGCTGACATTGTAGTCTTTGATGAAATCTCTATG
GCTACTAATTATGACTTGAGTGTTGTCAATGCTAGACTTCGTGCAAAACA
CTACGTCTATATTGGCGATCCTGCTCAATTACCAGCCCCCCGCACATTGC
TGACTAAAGGCACACTAGAACCAGAATATTTTAATTCAGTGTGCAGACTT
ATGAAAACAATAGGTCCAGACATGTTCCTTGGAACTTGTCGCCGTTGTCC
TGCTGAAATTGTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAA
AAGCACACAAGGATAAGTCAGCTCAATGCTTCAAAATGTTCTACAAAGGT
GTTATTACACATGATGTTTCATCTGCAATCAACAGACCTCAAATAGGCGT
TGTAAGAGAATTTCTTACACGCAATCCTGCTTGGAGAAAAGCTGTTTTTA
TCTCACCTTATAATTCACAGAACGCTGTAGCTTCAAAAATCTTAGGATTG
CCTACGCAGACTGTTGATTCATCACAGGGTTCTGAATATGACTATGTCAT
ATTCACACAAACTACTGAAACAGCACACTCTTGTAATGTCAACCGCTTCA
ATGTGGCTATCACAAGGGCAAAAATTGGCATTTTGTGCATAATGTCTGAT
AGAGATCTTTATGACAAACTGCAATTTACAAGTCTAGAAATACCACGTCG
CAATGTGGCTACATTACAAGCAGAAAATGTAACTGGACTTTTTAAGGACT
GTAGTAAGATCATTACTGGTCTTCATCCTACACAGGCACCTACACACCTC
AGCGTTGATATAAAGTTCAAGACTGAAGGATTATGTGTTGACATACCAGG
CATACCAAAGGACATGACCTACCGTAGACTCATCTCTATGATGGGTTTCA
AAATGAATTACCAAGTCAATGGTTACCCTAATATGTTTATCACCCGCGAA
GAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTG
TCATGCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGAT
TTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGTTGACACT
GAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTGA
CCAGTTTAAACATCTTATACCACTCATGTATAAAGGCTTGCCCTGGAATG
TAGTGCGTATTAAGATAGTACAAATGCTCAGTGATACACTGAAAGGATTG
TCAGACAGAGTCGTGTTCGTCCTTTGGGCGCATGGCTTTGAGCTTACATC
AATGAAGTACTTTGTCAAGATTGGACCTGAAAGAACGTGTTGTCTGTGTG
ACAAACGTGCAACTTGCTTTTCTACTTCATCAGATACTTATGCCTGCTGG
AATCATTCTGTGGGTTTTGACTATGTCTATAACCCATTTATGATTGATGT
TCAGCAGTGGGGCTTTACGGGTAACCTTCAGAGTAACCATGACCAACATT
GCCAGGTACATGGAAATGCACATGTGGCTAGTTGTGATGCTATCATGACT
AGATGTTTAGCAGTCCATGAGTGCTTTGTTAAGCGCGTTGATTGGTCTGT
TGAATACCCTATTATAGGAGATGAACTGAGGGTTAATTCTGCTTGCAGAA
AAGTACAACACATGGTTGTGAAGTCTGCATTGCTTGCTGATAAGTTTCCA
GTTCTTCATGACATTGGAAATCCAAAGGCTATCAAGTGTGTGCCTCAGGC
TGAAGTAGAATGGAAGTTCTACGATGCTCAGCCATGTAGTGACAAAGCTT
ACAAAATAGAGGAACTCTTCTATTCTTATGCTACACATCACGATAAATTC
ACTGATGGTGTTTGTTTGTTTTGGAATTGTAACGTTGATCGTTACCCAGC
CAATGCAATTGTGTGTAGGTTTGACACAAGAGTCTTGTCAAACTTGAACT
TACCAGGCTGTGATGGTGGTAGTTTGTATGTGAATAAGCATGCATTCCAC
ACTCCAGCTTTCGATAAAAGTGCATTTACTAATTTAAAGCAATTGCCTTT
CTTTTACTATTCTGATAGTCCTTGTGAGTCTCATGGCAAACAAGTAGTGT
CGGATATTGATTATGTTCCACTCAAATCTGCTACGTGTATTACACGATGC
AATTTAGGTGGTGCTGTTTGCAGACACCATGCAAATGAGTACCGACAGTA
CTTGGATGCATATAATATGATGATTTCTGCTGGATTTAGCCTATGGATTT
ACAAACAATTTGATACTTATAACCTGTGGAATACATTTACCAGGTTACAG
AGTTTAGAAAATGTGGCTTATAATGTTGTTAATAAAGGACACTTTGATGG
ACACGCCGGCGAAGCACCTGTTTCCATCATTAATAATGCTGTTTACACAA
AGGTAGATGGTATTGATGTGGAGATCTTTGAAAATAAGACAACACTTCCT
GTTAATGTTGCATTTGAGCTTTGGGCTAAGCGTAACATTAAACCAGTGCC
AGAGATTAAGATACTCAATAATTTGGGTGTTGATATCGCTGCTAATACTG
TAATCTGGGACTACAAAAGAGAAGCCCCAGCACATGTATCTACAATAGGT
GTCTGCACAATGACTGACATTGCCAAGAAACCTACTGAGAGTGCTTGTTC
TTCACTTACTGTCTTGTTTGATGGTAGAGTGGAAGGACAGGTAGACCTTT
TTAGAAACGCCCGTAATGGTGTTTTAATAACAGAAGGTTCAGTCAAAGGT
CTAACACCTTCAAAGGGACCAGCACAAGCTAGCGTCAATGGAGTCACATT
AATTGGAGAATCAGTAAAAACACAGTTTAACTACTTTAAGAAAGTAGACG
GCATTATTCAACAGTTGCCTGAAACCTACTTTACTCAGAGCAGAGACTTA
GAGGATTTTAAGCCCAGATCACAAATGGAAACTGACTTTCTCGAGCTCGC
TATGGATGAATTCATACAGCGATATAAGCTCGAGGGCTATGCCTTCGAAC
ACATCGTTTATGGAGATTTCAGTCATGGACAACTTGGCGGTCTTCATTTA
ATGATAGGCTTAGCCAAGCGCTCACAAGATTCACCACTTAAATTAGAGGA
TTTTATCCCTATGGACAGCACAGTGAAAAATTACTTCATAACAGATGCGC
AAACAGGTTCATCAAAATGTGTGTGTTCTGTGATTGATCTTTTACTTGAT
GACTTTGTCGAGATAATAAAGTCACAAGATTTGTCAGTGATTTCAAAAGT
GGTCAAGGTTACAATTGACTATGCTGAAATTTCATTCATGCTTTGGTGTA
AGGATGGACATGTTGAAACCTTCTACCCAAAACTACAAGCAAGTCAAGCG
TGGCAACCAGGTGTTGCGATGCCTAACTTGTACAAGATGCAAAGAATGCT
TCTTGAAAAGTGTGACCTTCAGAATTATGGTGAAAATGCTGTTATACCAA
AAGGAATAATGATGAATGTCGCAAAGTATACTCAACTGTGTCAATACTTA
AATACACTTACTTTAGCTGTACCCTACAACATGAGAGTTATTCACTTTGG
TGCTGGCTCTGATAAAGGAGTTGCACCAGGTACAGCTGTGCTCAGACAAT
GGTTGCCAACTGGCACACTACTTGTCGATTCAGATCTTAATGACTTCGTC
TCCGACGCAGATTCTACTTTAATTGGAGACTGTGCAACAGTACATACGGC
TAATAAATGGGACCTTATTATTAGCGATATGTATGACCCTAGGACCAAAC
ATGTGACAAAAGAGAATGACTCTAAAGAAGGGTTTTTCACTTATCTGTGT
GGATTTATAAAGCAAAAACTAGCCCTGGGTGGTTCTATAGCTGTAAAGAT
AACAGAGCATTCTTGGAATGCTGACCTTTACAAGCTTATGGGCCATTTCT
CATGGTGGACAGCTTTTGTTACAAATGTAAATGCATCATCATCGGAAGCA
TTTTTAATTGGGGCTAACTATCTTGGCAAGCCGAAGGAACAAATTGATGG
CTATACCATGCATGCTAACTACATTTTCTGGAGGAACACAAATCCTATCC
AGTTGTCTTCCTATTCACTCTTTGACATGAGCAAATTTCCTCTTAAATTA
AGAGGAACTGCTGTAATGTCTCTTAAGGAGAATCAAATCAATGATATGAT
TTATTCTCTTCTGGAAAAAGGTAGGCTTATCATTAGAGAAAACAACAGAG
TTGTGGTTTCAAGTGATATTCTTGTTAACAACTAAACGAACATGTTTATT
TTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCAC
CACTTTTGATGATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTA
TGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCTTTAT
TTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCA
TACTATTAATCATACGTTTGGCAACCCTGTCATACCTTTTAAGGATGGTA
TTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTT
GGTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTC
TACTAATGTTGTTATACGAGCATGTAACTTTGAATTGTGTGACAACCCTT
TCTTTGCTGTTTCTAAACCCATGGGTACACAGACACATACTATGATATTC
GATAATGCATTTAATTGCACTTTCGAGTACATATCTGATGCCTTTTCGCT
TGATGTTTCAGAAAAGTCAGGTAATTTTAAACACTTACGAGAGTTTGTGT
TTAAAAATAAAGATGGGTTTCTCTATGTTTATAAGGGCTATCAACCTATA
GATGTAGTTCGTGATCTACCTTCTGGTTTTAACACTTTGAAACCTATTTT
TAAGTTGCCTCTTGGTATTAACATTACAAATTTTAGAGCCATTCTTACAG
CCTTTTCACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTATTTT
GTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATGAAAATGG
TACAATCACAGATGCTGTTGATTGTTCTCAAAATCCACTTGCTGAACTCA
AATGCTCTGTTAAGAGCTTTGAGATTGACAAAGGAATTTACCAGACCTCT
AATTTCAGGGTTGTTCCCTCAGGAGATGTTGTGAGATTCCCTAATATTAC
AAACTTGTGTCCTTTTGGAGAGGTTTTTAATGCTACTAAATTCCCTTCTG
TCTATGCATGGGAGAGAAAAAAAATTTCTAATTGTGTTGCTGATTACTCT
GTGCTCTACAACTCAACATTTTTTTCAACCTTTAAGTGCTATGGCGTTTC
TGCCACTAAGTTGAATGATCTTTGCTTCTCCAATGTCTATGCAGATTCTT
TTGTAGTCAAGGGAGATGATGTAAGACAAATAGCGCCAGGACAAACTGGT
GTTATTGCTGATTATAATTATAAATTGCCAGATGATTTCATGGGTTGTGT
CCTTGCTTGGAATACTAGGAACATTGATGCTACTTCAACTGGTAATTATA
ATTATAAATATAGGTATCTTAGACATGGCAAGCTTAGGCCCTTTGAGAGA
GACATATCTAATGTGCCTTTCTCCCCTGATGGCAAACCTTGCACCCCACC
TGCTCTTAATTGTTATTGGCCATTAAATGATTATGGTTTTTACACCACTA
CTGGCATTGGCTACCAACCTTACAGAGTTGTAGTACTTTCTTTTGAACTT
TTAAATGCACCGGCCACGGTTTGTGGACCAAAATTATCCACTGACCTTAT
TAAGAACCAGTGTGTCAATTTTAATTTTAATGGACTCACTGGTACTGGTG
TGTTAACTCCTTCTTCAAAGAGATTTCAACCATTTCAACAATTTGGCCGT
GATGTTTCTGATTTCACTGATTCCGTTCGAGATCCTAAAACATCTGAAAT
ATTAGACATTTCACCTTGCGCTTTTGGGGGTGTAAGTGTAATTACACCTG
GAACAAATGCTTCATCTGAAGTTGCTGTTCTATATCAAGATGTTAACTGC
ACTGATGTTTCTACAGCAATTCATGCAGATCAACTCACACCAGCTTGGCG
CATATATTCTACTGGAAACAATGTATTCCAGACTCAAGCAGGCTGTCTTA
TAGGAGCTGAGCATGTCGACACTTCTTATGAGTGCGACATTCCTATTGGA
GCTGGCATTTGTGCTAGTTACCATACAGTTTCTTTATTACGTAGTACTAG
CCAAAAATCTATTGTGGCTTATACTATGTCTTTAGGTGCTGATAGTTCAA
TTGCTTACTCTAATAACACCATTGCTATACCTACTAACTTTTCAATTAGC
ATTACTACAGAAGTAATGCCTGTTTCTATGGCTAAAACCTCCGTAGATTG
TAATATGTACATCTGCGGAGATTCTACTGAATGTGCTAATTTGCTTCTCC
AATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCT
GCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAAT
GTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAA
TATTACCTGACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTG
CTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGAAGCAATATGG
CGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGT
TCAATGGACTTACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCT
GCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATGGACATT
TGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATA
GGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAA
CAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACT
TACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGA
ATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGT
GCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGA
GGCGGAGGTACAAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTC
AAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCT
GCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAA
AAGAGTTGACTTTTGTGGAAAGGGCTACCACCTTATGTCCTTCCCACAAG
CAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCCAG
GAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATA
CTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTA
CACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTT
GTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTA
TGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGT
ACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGC
ATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGA
GGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAA
AATATGAGCAATATATTAAATGGCCTTGGTATGTTTGGCTCGGCTTCATT
GCTGGACTAATTGCCATCGTCATGGTTACAATCTTGCTTTGTTGCATGAC
TAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCA
AGTTTGATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACAT
TACACATAAACGAACTTATGGATTTGTTTATGAGATTTTTTACTCTTAGA
TCAATTACTGCACAGCCAGTAAAAATTGACAATGCTTCTCCTGCAAGTAC
TGTTCATGCTACAGCAACGATACCGCTACAAGCCTCACTCCCTTTCGGAT
GGCTTGTTATTGGCGTTGCATTTCTTGCTGTTTTTCAGAGCGCTACCAAA
ATAATTGCGCTCAATAAAAGATGGCAGCTAGCCCTTTATAAGGGCTTCCA
GTTCATTTGCAATTTACTGCTGCTATTTGTTACCATCTATTCACATCTTT
TGCTTGTCGCTGCAGGTATGGAGGCGCAATTTTTGTACCTCTATGCCTTG
ATATATTTTCTACAATGCATCAACGCATGTAGAATTATTATGAGATGTTG
GCTTTGTTGGAAGTGCAAATCCAAGAACCCATTACTTTATGATGCCAACT
ACTTTGTTTGCTGGCACACACATAACTATGACTACTGTATACCATATAAC
AGTGTCACAGATACAATTGTCGTTACTGAAGGTGACGGCATTTCAACACC
AAAACTCAAAGAAGACTACCAAATTGGTGGTTATTCTGAGGATAGGCACT
CAGGTGTTAAAGACTATGTCGTTGTACATGGCTATTTCACCGAAGTTTAC
TACCAGCTTGAGTCTACACAAATTACTACAGACACTGGTATTGAAAATGC
TACATTCTTCATCTTTAACAAGCTTGTTAAAGACCCACCGAATGTGCAAA
TACACACAATCGACGGCTCTTCAGGAGTTGCTAATCCAGCAATGGATCCA
ATTTATGATGAGCCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGA
AAGTGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAAACAGGTACGT
TAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTA
GTCACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAA
TATTGTTAACGTGAGTTTAGTAAAACCAACGGTTTACGTCTACTCGCGTG
TTAAAAATCTGAACTCTTCTGAAGGAGTTCCTGATCTTCTGGTCTAAACG
AACTAACTATTATTATTATTCTGTTTGGAACTTTAACATTGCTTATCATG
GCAGACAACGGTACTATTACCGTTGAGGAGCTTAAACAACTCCTGGAACA
ATGGAACCTAGTAATAGGTTTCCTATTCCTAGCCTGGATTATGTTACTAC
AATTTGCCTATTCTAATCGGAACAGGTTTTTGTACATAATAAAGCTTGTT
TTCCTCTGGCTCTTGTGGCCAGTAACACTTGCTTGTTTTGTGCTTGCTGC
TGTCTACAGAATTAATTGGGTGACTGGCGGGATTGCGATTGCAATGGCTT
GTATTGTAGGCTTGATGTGGCTTAGCTACTTCGTTGCTTCCTTCAGGCTG
TTTGCTCGTACCCGCTCAATGTGGTCATTCAACCCAGAAACAAACATTCT
TCTCAATGTGCCTCTCCGGGGGACAATTGTGACCAGACCGCTCATGGAAA
GTGAACTTGTCATTGGTGCTGTGATCATTCGTGGTCACTTGCGAATGGCC
GGACACTCCCTAGGGCGCTGTGACATTAAGGACCTGCCAAAAGAGATCAC
TGTGGCTACATCACGAACGCTTTCTTATTACAAATTAGGAGCGTCGCAGC
GTGTAGGCACTGATTCAGGTTTTGCTGCATACAACCGCTACCGTATTGGA
AACTATAAATTAAATACAGACCACGCCGGTAGCAACGACAATATTGCTTT
GCTAGTACAGTAAGTGACAACAGATGTTTCATCTTGTTGACTTCCAGGTT
ACAATAGCAGAGATATTGATTATCATTATGAGGACTTTCAGGATTGCTAT
TTGGAATCTTGACGTTATAATAAGTTCAATAGTGAGACAATTATTTAAGC
CTCTAACTAAGAAGAATTATTCGGAGTTAGATGATGAAGAACCTATGGAG
TTAGATTATCCATAAAACGAACATGAAAATTATTCTCTTCCTGACATTGA
TTGTATTTACATCTTGCGAGCTATATCACTATCAGGAGTGTGTTAGAGGT
ACGACTGTACTACTAAAAGAACCTTGCCCATCAGGAACATACGAGGGCAA
TTCACCATTTCACCCTCTTGCTGACAATAAATTTGCACTAACTTGCACTA
GCACACACTTTGCTTTTGCTTGTGCTGACGGTACTCGACATACCTATCAG
CTGCGTGCAAGATCAGTTTCACCAAAACTTTTCATCAGACAAGAGGAGGT
TCAACAAGAGCTCTACTCGCCACTTTTTCTCATTGTTGCTGCTCTAGTAT
TTTTAATACTTTGCTTCACCATTAAGAGAAAGACAGAATGAATGAGCTCA
CTTTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTT
TTAATAATGCTTATTATATTTTGGTTTTCACTCGAAATCCAGGATCTAGA
AGAACCTTGTACCAAAGTCTAAACGAACATGAAACTTCTCATTGTTTTGA
CTTGTATTTCTCTATGCAGTTGCATATGCACTGTAGTACAGCGCTGTGCA
TCTAATAAACCTCATGTGCTTGAAGATCCTTGTAAGGTACAACACTAGGG
GTAATACTTATAGCACTGCTTGGCTTTGTGCTCTAGGAAAGGTTTTACCT
TTTCATAGATGGCACACTATGGTTCAAACATGCACACCTAATGTTACTAT
CAACTGTCAAGATCCAGCTGGTGGTGCGCTTATAGCTAGGTGTTGGTACC
TTCATGAAGGTCACCAAACTGCTGCATTTAGAGACGTACTTGTTGTTTTA
AATAAACGAACAAATTAAAATGTCTGATAATGGACCCCAATCAAACCAAC
GTAGTGCCCCCCGCATTACATTTGGTGGACCCACAGATTCAACTGACAAT
AACCAGAATGGAGGACGCAATGGGGCAAGGCCAAAACAGCGCCGACCCCA
AGGTTTACCCAATAATACTGCGTCTTGGTTCACAGCTCTCACTCAGCATG
GCAAGGAGGAACTTAGATTCCCTCGAGGCCAGGGCGTTCCAATCAACACC
AATAGTGGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCCGACG
AGTTCGTGGTGGTGACGGCAAAATGAAAGAGCTCAGCCCCAGATGGTACT
TCTATTACCTAGGAACTGGCCCAGAAGCTTCACTTCCCTACGGCGCTAAC
AAAGAAGGCATCGTATGGGTTGCAACTGAGGGAGCCTTGAATACACCCAA
AGACCACATTGGCACCCGCAATCCTAATAACAATGCTGCCACCGTGCTAC
AACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAGGGAAGC
AGAGGCGGCAGTCAAGCCTCTTCTCGCTCCTCATCACGTAGTCGCGGTAA
TTCAAGAAATTCAACTCCTGGCAGCAGTAGGGGAAATTCTCCTGCTCGAA
TGGCTAGCGGAGGTGGTGAAACTGCCCTCGCGCTATTGCTGCTAGACAGA
TTGAACCAGCTTGAGAGCAAAGTTTCTGGTAAAGGCCAACAACAACAAGG
CCAAACTGTCACTAAGAAATCTGCTGCTGAGGCATCTAAAAAGCCTCGCC
AAAAACGTACTGCCACAAAACAGTACAACGTCACTCAAGCATTTGGGAGA
CGTGGTCCAGAACAAACCCAAGGAAATTTCGGGGACCAAGACCTAATCAG
ACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCTCCAA
GTGCCTCTGCATTCTTTGGAATGTCACGCATTGGCATGGAAGTCACACCT
TCGGGAACATGGCTGACTTATCATGGAGCCATTAAATTGGATGACAAAGA
TCCACAATTCAAAGACAACGTCATACTGCTGAACAAGCACATTGACGCAT
ACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAAAAGACT
GATGAAGCTCAGCCTTTGCCGCAGAGACAAAAGAAGCAGCCCACTGTGAC
TCTTCTTCCTGCGGCTGACATGGATGATTTCTCCAGACAACTTCAAAATT
CCATGAGTGGAGCTTCTGCTGATTCAACTCAGGCATAAACACTCATGATG
ACCACACAAGGCAGATGGGCTATGTAAACGTTTTCGCAATTCCGTTTACG
ATACATAGTCTACTCTTGTGCAGAATGAATTCTCGTAACTAAACAGCACA
AGTAGGTTTAGTTAACTTTAATCTCACATAGCAATCTTTAATCAATGTGT
AACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCATCGAGGCCACGC
GGAGTACGATCGAGGGTACAGTGAATAATGCTAGGGAGAGCTGCCTATAT
GGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTG
ATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAA
A

5 Responses to "The SARS Genome"

  1. GATACAAAAA!!!!!!!

  2. I think you missed an A.

  3. Great blog, dude! I mean, its one of the best 'people that I dont know' blog. Anyways... about the SARS genome:

    Why would you post it here? Do you want me to get it? I mean with this information I could make even more people infected with this 'cold-like' (with worse effects) disease!!! OMG, Im gonna go replicate it right now! >:-o

    Yes, I am paranoid and stupid, but dont tell anyone 😉

  4. SARS!!!

    I am cutting and pasting the SARS genome into this blog entry!! Click on the little linky to see the whole thing 🙂 Via "Core/Dump":http://weblog.soulhuntre.com/archives/001417.ascx and "nsLog()":http://nslog.com/archives/2003/05/05/the_sars_genome.php

  5. X2: DNA Attacks

    Erik posted the SARS genome today. On a seemingly unrelated (only seemingly though) I saw XMen 2 today. I thought it was pretty good. Not as good as EQUILIBRIUM though. When they started to talk about genetics, though, I wanted...


Trackback URI | Comments RSS

Leave a Reply

Please abide by the comment policy. Valid HTML includes: <blockquote><p>, <em>, <strong>, <ul>, <ol>, and <a href>. Please use the "Quote Me" functionality to quote comments.